Using the codon table provided, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon.
I. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
II. aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
Notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.